Biochemistry

The DNA molecule below was digested with EcoRI

The DNA molecule below was digested with EcoRI.

5’ AGATGAATTCGCTGAAGAACCAAGAATTCGATT 3’

3’ TCTACTTAAGCGACTTCTTGGTTCTTAAGCTAA 5’

How many molecules of DNA were the result of this reaction?

What were the sequences of each? (note 5’ and 3’ ends)

Answer

3 DNA molecules:

5’  AGATG 3’         5’ AATTCGCTGAAGAACCAAG 3’               5’ AATTCGATT 3’

3’ TCTACTTAA 5’            3’ GCGACTTCTTGGTTCTTAA 5’                3’ GCTAA 5’

Categories: Biochemistry, Biology