Restrictions Enzymes

5 (100%) 7 votes

Enzyme Recognition Sequence
AclI AA/CGTT
HindIII HindIII-HF® A/AGCTT
SspI SspI-HF® AAT/ATT
MluCI Tsp509I /AATT
PciI A/CATGT
AgeI AgeI-HF® AgeI-HF® RE-Mix® A/CCGGT
BspMI BfuAI ACCTGC(4/8)
SexAI A/CCWGGT
MluI A/CGCGT
MluI-HF® ACGCGT
BceAI ACGGC(12/14)
HpyCH4IV A/CGT
HpyCH4III ACN/GT
BaeI (10/15)ACNNNNGTAYC(12/7)
BsaXI (9/12)ACNNNNNCTCC(10/7)
AflIII A/CRYGT
SpeI SpeI-HF® SpeI RE-Mix® A/CTAGT
BsrI ACTGG(1/-1)
BmrI ACTGGG(5/4)
BglII A/GATCT
AfeI AGC/GCT
AluI AG/CT
StuI AGG/CCT
ScaI ScaI-HF® ScaI-HF® RE-Mix® AGT/ACT
ClaI BspDI AT/CGAT
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
NsiI ATGCA/T
NsiI-HF® ATGCAT
AseI AT/TAAT
SwaI ATTT/AAAT
CspCI (11/13)CAANNNNNGTGG(12/10)
MfeI MfeI-HF® MfeI-HF® RE-Mix® C/AATTG
BssSI CACGAG(-5/-1)
BssSαI CACGAG
BmgBI CACGTC(-3/-3)
PmlI CAC/GTG
DraIII DraIII-HF® CACNNN/GTG
AleI CACNN/NNGTG
EcoP15I CAGCAG(25/27)
PvuII PvuII-HF® CAG/CTG
AlwNI CAGNNN/CTG
BtsIMutI CAGTG(2/0)
TspRI NNCASTGNN/
NdeI CA/TATG
NlaIII CATG/
CviAII C/ATG
FatI /CATG
MslI CAYNN/NNRTG
FspEI CC(12/16)
XcmI CCANNNNN/NNNNTGG
BstXI CCANNNNN/NTGG
PflMI CCANNNN/NTGG
BccI CCATC(4/5)
NcoI NcoI-HF® NcoI-HF® RE-Mix® C/CATGG
BseYI CCCAGC(-5/-1)
FauI CCCGC(4/6)
SmaI CCC/GGG
XmaI TspMI C/CCGGG
Nt.CviPII (0/-1)CCD
LpnPI CCDG(10/14)
AciI CCGC(-3/-1)
SacII CCGC/GG
BsrBI CCGCTC(-3/-3)
MspI HpaII C/CGG
ScrFI CC/NGG
BssKI StyD4I /CCNGG
BsaJI C/CNNGG
BslI CCNNNNN/NNGG
BtgI C/CRYGG
NciI CC/SGG
AvrII C/CTAGG
MnlI CCTC(7/6)
BbvCI CCTCAGC(-5/-2)
Nb.BbvCI CCTCAGC
Nt.BbvCI CCTCAGC(-5/-7)
SbfI SbfI-HF® CCTGCA/GG
Bpu10I CCTNAGC(-5/-2)
Bsu36I CC/TNAGG
EcoNI CCTNN/NNNAGG
HpyAV CCTTC(6/5)
BstNI CC/WGG
PspGI /CCWGG
StyI StyI-HF® C/CWWGG
BcgI (10/12)CGANNNNNNTGC(12/10)
PvuI PvuI-HF® CGAT/CG
BstUI CG/CG
EagI EagI-HF® C/GGCCG
RsrII CG/GWCCG
BsiEI CGRY/CG
BsiWI C/GTACG
BsmBI CGTCTC(1/5)
Hpy99I CGWCG/
MspA1I CMG/CKG
MspJI CNNR(9/13)
SgrAI CR/CCGGYG
BfaI C/TAG
BspCNI CTCAG(9/7)
XhoI PaeR7I TliI XhoI RE-Mix® C/TCGAG
EarI CTCTTC(1/4)
AcuI CTGAAG(16/14)
PstI PstI-HF® CTGCA/G
BpmI CTGGAG(16/14)
DdeI C/TNAG
SfcI C/TRYAG
AflII C/TTAAG
BpuEI CTTGAG(16/14)
SmlI C/TYRAG
AvaI BsoBI C/YCGRG
MboII GAAGA(8/7)
BbsI GAAGAC(2/6)
XmnI GAANN/NNTTC
BsmI GAATGC(1/-1)
Nb.BsmI GAATGC
EcoRI EcoRI-HF® EcoRI-HF® RE-Mix® G/AATTC
HgaI GACGC(5/10)
AatII GACGT/C
ZraI GAC/GTC
Tth111I PflFI GACN/NNGTC
PshAI GACNN/NNGTC
AhdI GACNNN/NNGTC
DrdI GACNNNN/NNGTC
Eco53kI GAG/CTC
SacI SacI-HF® GAGCT/C
BseRI GAGGAG(10/8)
PleI GAGTC(4/5)
Nt.BstNBI GAGTC(4/-5)
MlyI GAGTC(5/5)
HinfI G/ANTC
EcoRV EcoRV-HF® EcoRV-HF® RE-Mix® GAT/ATC
MboI Sau3AI DpnII BfuCI /GATC
DpnI GA/TC
BsaBI GATNN/NNATC
TfiI G/AWTC
BsrDI GCAATG(2/0)
Nb.BsrDI GCAATG
BbvI GCAGC(8/12)
BtsI GCAGTG(2/0)
BtsαI Nb.BtsI GCAGTG
BstAPI GCANNNN/NTGC
SfaNI GCATC(5/9)
SphI SphI-HF® GCATG/C
NmeAIII GCCGAG(21/19)
NaeI GCC/GGC
NgoMIV G/CCGGC
BglI GCCNNNN/NGGC
AsiSI GCGAT/CGC
BtgZI GCGATG(10/14)
HinP1I G/CGC
HhaI GCG/C
BssHII G/CGCGC
NotI NotI-HF® NotI-HF® RE-Mix® GC/GGCCGC
Fnu4HI GC/NGC
Cac8I GCN/NGC
MwoI GCNNNNN/NNGC
NheI NheI-HF® NheI-HF® RE-Mix® G/CTAGC
BmtI BmtI-HF® GCTAG/C
SapI BspQI GCTCTTC(1/4)
Nt.BspQI GCTCTTC(1/-7)
BlpI GC/TNAGC
TseI ApeKI G/CWGC
Bsp1286I GDGCH/C
AlwI GGATC(4/5)
Nt.AlwI GGATC(4/-5)
BamHI BamHI-HF® G/GATCC
FokI GGATG(9/13)
BtsCI GGATG(2/0)
HaeIII PhoI GG/CC
FseI GGCCGG/CC
SfiI GGCCNNNN/NGGCC
NarI GG/CGCC
KasI G/GCGCC
SfoI GGC/GCC
PluTI GGCGC/C
AscI AscI RE-Mix® GG/CGCGCC
EciI GGCGGA(11/9)
BsmFI GGGAC(10/14)
ApaI GGGCC/C
PspOMI G/GGCCC
Sau96I G/GNCC
NlaIV GGN/NCC
KpnI KpnI-HF® KpnI-HF® RE-Mix® GGTAC/C
Acc65I G/GTACC
BsaI BsaI-HF® GGTCTC(1/5)
HphI GGTGA(8/7)
BstEII BstEII-HF® BstEII-HF® RE-Mix® G/GTNACC
AvaII G/GWCC
BanI G/GYRCC
BaeGI GKGCM/C
BsaHI GR/CGYC
BanII GRGCY/C
RsaI GT/AC
CviQI G/TAC
BstZ17I GTA/TAC
BciVI GTATCC(6/5)
SalI SalI-HF® SalI-HF® RE-Mix® G/TCGAC
Nt.BsmAI GTCTC(1/-5)
BsmAI BcoDI GTCTC(1/5)
ApaLI G/TGCAC
BsgI GTGCAG(16/14)
AccI GT/MKAC
Hpy166II GTN/NAC
Tsp45I /GTSAC
HpaI GTT/AAC
PmeI GTTT/AAAC
HincII GTY/RAC
BsiHKAI GWGCW/C
ApoI R/AATTY
NspI RCATG/Y
BsrFI R/CCGGY
BstYI R/GATCY
HaeII RGCGC/Y
CviKI-1 RG/CY
EcoO109I RG/GNCCY
PpuMI RG/GWCCY
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
SnaBI TAC/GTA
I-SceI TAGGGATAACAGGGTAAT(-9/-13)
BspHI T/CATGA
BspEI T/CCGGA
MmeI TCCRAC(20/18)
TaqαI T/CGA
NruI TCG/CGA
NruI-HF® TCGCGA
Hpy188I TCN/GA
Hpy188III TC/NNGA
XbaI XbaI RE-Mix® T/CTAGA
BclI T/GATCA
HpyCH4V TG/CA
FspI TGC/GCA
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
MscI TGG/CCA
BsrGI T/GTACA
BsrGI-HF® TGTACA
MseI T/TAA
PacI PacI RE-Mix® TTAAT/TAA
PsiI TTA/TAA
BstBI TT/CGAA
DraI TTT/AAA
PspXI VC/TCGAGB
BsaWI W/CCGGW
BsaAI YAC/GTR
EaeI Y/GGCCR